Restriction Site Finder

About Restriction Site Finder

This tool searches a DNA sequence for the recognition sites of 15 common restriction enzymes and reports how many times each cuts, where each site begins and where the top strand is cut. It is a quick check before cloning: it shows which enzymes cut your insert, and how many times.

How to use it

1. Paste the DNA sequence into the Sequence box. The badges show its length, the number of enzymes with hits and the total number of sites.
2. Read the Recognition sites table, which lists only enzymes that cut at least once, sorted by number of sites.
3. For each enzyme, read the start position and the cut position in parentheses.
4. Use Copy table to export enzyme, site, count and positions as tab-separated text.

A short multi-site sequence

GAATTCGGGAAGCTTCCCGGATCCAAATTTGGGGTCGACTTTAAACTGCAGGGGGAATTCAAA

EcoRI 2 sites: 1 (1), 55 (55). BamHI 19 (19). HindIII 10 (10). PstI 46 (50). SalI 34 (34).

When to use it

• Finding an enzyme that does not cut inside a gene, so it can be used at the cloning junction.
• Checking that a multiple cloning site contains each enzyme only once.
• Predicting which restriction digest will give a diagnostic band pattern.
• Confirming that a mutation removed or created a recognition site.

Questions about Restriction Site Finder

Which enzymes are searched?

EcoRI, BamHI, HindIII, NotI, XhoI, PstI, SmaI, KpnI, SacI, SalI, XbaI, NcoI, NdeI, SpeI and EcoRV. Only these fixed, unambiguous sites are looked up.

How should I read the cut position?

It is the 1-based number of the top-strand base after which the cut falls. EcoRI cuts G^AATTC, so a site starting at 1 cuts after base 1. PstI cuts CTGCA^G, four bases past the site start.

Why only the top strand?

All 15 recognition sites are palindromic, so each one reads the same on both strands. A single scan therefore finds every site.

What does it not tell me?

It ignores methylation sensitivity, buffer compatibility, star activity and overhang type. It treats the sequence as linear, so a site spanning the origin of a circular plasmid is missed.

Related tools

• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• DNA to Protein TranslationTranslate a DNA or RNA sequence into protein across reading frames using the standard genetic code.
• ORF FinderFind open reading frames (ATG to stop) across all six frames, with position, length, and protein.
• GC Content CalculatorCalculate GC%, AT%, base counts, and a basic melting temperature for a DNA sequence.
• Sequence StatsLength, base composition, GC%, and approximate molecular weight for raw or FASTA sequences.