ORF Finder

About ORF Finder

This tool scans a DNA sequence for open reading frames, stretches that begin with ATG and run in frame to the next stop codon. It checks all three forward frames and, optionally, the three reverse-strand frames, then lists each ORF with its strand, frame, position, length and encoded protein, longest first.

How to use it

1. Paste the DNA sequence into the Sequence box.
2. Set Min. protein length (aa) to the shortest ORF you care about. The default is 10 and the smallest allowed value is 1.
3. Leave Search reverse strand ticked to include the minus strand, or clear it to search only the sequence as pasted.
4. Review the list under Open reading frames and use Copy protein on any entry.

Lowering the minimum to see short ORFs

GGGATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATGAGCTTAAGCGTACGTTAGCCGTAGCGTACGGGCATGAAACCCGGGTTTTAGCC, minimum 3 aa

+ frame 1, pos 4-27, 24 nt, MAIVMGR; + frame 3, pos 39-59, MSLSVR; - frame 1, pos 56-76, MPVRYG; + frame 3, pos 75-92, MKPGF

When to use it

• Finding the likely protein-coding region in an unannotated bacterial or viral fragment.
• Choosing which frame of a cDNA clone to express by locating its longest ORF.
• Checking which strand a gene lies on before designing primers.
• Screening a plasmid insert for unintended long ORFs on the opposite strand.

Questions about ORF Finder

Why does the sample sequence show no ORFs at first?

Its ORFs are only five to seven residues long and the default minimum is 10 amino acids. Lower the minimum and they appear. It is a good reminder that this threshold controls everything you see.

Are positions counted on the reverse strand too?

Yes, but they are reported in forward-strand coordinates, 1-based and inclusive, so you can locate a minus-strand ORF directly in the sequence you pasted. Length includes the stop codon.

Will an ORF with no stop codon be reported?

No. An ATG that runs off the end of the sequence without reaching a stop is discarded, as are ATGs nested inside an ORF that has already started.

What minimum length is sensible?

In random sequence a stop appears about every 21 codons, so ORFs under 50 or so codons are frequently chance. For prokaryotic genes a minimum of around 100 amino acids removes most noise. Genomic eukaryotic DNA has introns that split genes, so use cDNA.

Related tools

• Six-Frame TranslationTranslate a DNA or RNA sequence in all six reading frames (three forward, three reverse) to find coding potential.
• DNA to Protein TranslationTranslate a DNA or RNA sequence into protein across reading frames using the standard genetic code.
• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• FASTA FormatterParse, clean, validate, and re-wrap FASTA records at a chosen line width.
• Codon OptimizerCodon-optimize a protein or coding sequence for E. coli, human, or yeast expression.
• Pairwise Sequence AlignmentGlobal Needleman–Wunsch alignment of two sequences with score, identity, and a visual alignment.