FASTA Formatter

About FASTA Formatter

This tool reads FASTA text, cleans each record and rewraps the sequence at a line width you choose. It repairs pastes with stray spaces and tabs, fills in a name for records with no header, and handles several records at once, so you can normalize a file before feeding it to software that is picky about layout.

How to use it

1. Paste FASTA or a raw sequence into the Input box. The counter shows how many records were parsed.
2. Set Line width. The default is 60, and an empty or invalid value falls back to 60.
3. Decide whether to keep Clean (keep only valid bases) ticked. Untick it for protein or when you need to preserve lowercase.
4. Copy the result from the Formatted FASTA block with Copy FASTA.

Rewrapping at width 30

>seq1 unwrapped example
ATGCGGCCGCTAGCTAGCGGCCATATTTGCAATGGCCGATCGATCGTAGCTAGCTAGCGATCGATCGATCGATCG
>seq2
atgc gtac gtta gccgta

>seq1 unwrapped example
ATGCGGCCGCTAGCTAGCGGCCATATTTGC
AATGGCCGATCGATCGTAGCTAGCTAGCGA
TCGATCGATCGATCG
>seq2
ATGCGTACGTTAGCCGTA

When to use it

• Reflowing a single very long sequence line into a fixed width so a text editor or diff tool can handle it.
• Removing spaces, tabs and numbering left by copying from a PDF or a GenBank entry.
• Giving header-less sequences a consistent name before they go into a multi-FASTA file.
• Matching the line length a downstream script or submission form expects.

Questions about FASTA Formatter

What does the Clean option remove?

It keeps only valid IUPAC nucleotide letters and the gap dash, uppercases them and converts U to T. Everything else is dropped, and it caps each record at 100,000 bases.

Can I use it on protein FASTA?

Yes, but untick Clean first. With it on, protein letters that are not nucleotide codes are deleted. With it off, only whitespace is removed and the case is preserved.

Will it lose soft-masked lowercase regions?

It will if Clean is on, because cleaning uppercases everything. Turn Clean off to keep lowercase masking intact while still rewrapping.

What happens to a record with no header?

It is named sequence_1, sequence_2 and so on according to its position. Blank lines are ignored and Windows line endings are handled.

Related tools

• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• Sequence StatsLength, base composition, GC%, and approximate molecular weight for raw or FASTA sequences.
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• ORF FinderFind open reading frames (ATG to stop) across all six frames, with position, length, and protein.
• GC Content CalculatorCalculate GC%, AT%, base counts, and a basic melting temperature for a DNA sequence.
• Pairwise Sequence AlignmentGlobal Needleman–Wunsch alignment of two sequences with score, identity, and a visual alignment.