GC Content Calculator

About GC Content Calculator

This tool counts the bases in a DNA sequence and reports GC percentage, AT percentage, length and a quick melting temperature from the Wallace rule. GC content matters because G-C pairs have three hydrogen bonds against two for A-T, so it shapes duplex stability, primer behavior and how a sequence performs in PCR or sequencing.

How to use it

1. Paste your DNA sequence into the Sequence box. RNA works too because U is read as T.
2. Read GC content, AT content and Length in the Composition grid.
3. Check the individual counts for A, T, G and C, plus Other for any ambiguity codes.
4. Look at the Wallace Tm tile only if your sequence is a short oligo of roughly 14 nucleotides or fewer.

A 26 bp sequence

ATGCGGCCGCTAGCTAGCGGCCATAT

GC 61.5%, AT 38.5%, A 5, T 5, G 8, C 8, Tm (Wallace) 84 C

When to use it

• Checking whether a primer falls in the commonly recommended 40 to 60 percent GC window.
• Spotting a high-GC template that may need a GC enhancer or a higher denaturation temperature.
• Comparing the base composition of a gene with its host genome.
• Getting a fast sanity check on a synthetic fragment before ordering.

Questions about GC Content Calculator

What is a typical GC percentage?

It varies widely by organism. The human genome averages about 41 percent, Escherichia coli about 51 percent, and some bacteria sit above 70 or below 30, so a single number is only meaningful against the right baseline.

Why do GC and AT sometimes add up to less than 100?

Both percentages use the total length as the denominator. Ambiguity codes such as N count toward length but toward neither GC nor AT, so they show up under Other.

Why is the Wallace Tm so high for my long sequence?

The rule is 2 degrees per A or T plus 4 per G or C, which grows linearly with length. It is only reasonable for very short oligos, so a 26-mer reading 84 C is not a real melting point.

Does it show GC content along the sequence?

No. It reports one value for everything you paste. To look at a local region, extract it first and paste only that piece.

Related tools

• Primer Tm CalculatorMelting temperature of a primer by nearest-neighbor, GC%, and Wallace methods with GC% and length.
• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• Sequence StatsLength, base composition, GC%, and approximate molecular weight for raw or FASTA sequences.
• FASTA FormatterParse, clean, validate, and re-wrap FASTA records at a chosen line width.
• Pairwise Sequence AlignmentGlobal Needleman–Wunsch alignment of two sequences with score, identity, and a visual alignment.