DNA to Protein Translation

About DNA to Protein Translation

This tool translates a DNA or RNA sequence into a protein using the standard genetic code. You can translate a single reading frame or show all six frames at once, and you can cut the output at the first stop codon. Stops appear as an asterisk, so you can see exactly where a frame terminates.

How to use it

1. Paste the DNA or RNA into the Nucleotide sequence box. The caption shows base count and complete codons.
2. Pick Frame +1, +2 or +3 in the Reading frame menu, or choose All 6 frames.
3. Tick Stop at first stop codon if you want the protein truncated where translation would end.
4. Read each frame's protein in its own block, with the residue count beside the label, and copy the one you need.

Three forward frames of one sequence

ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG

+1: MAIVMGR*KGAR*   +2: WPL*WAAERVPD   +3: GHCNGPLKGCPI   (stop at first stop, frame +1: MAIVMGR)

When to use it

• Checking that a synthesized insert encodes the intended protein before you order it.
• Seeing which frame of a cDNA fragment is open when you only know part of the sequence.
• Confirming that a point mutation in a coding region changes, or does not change, an amino acid.
• Translating an RNA sequence copied from a paper into its peptide.

Questions about DNA to Protein Translation

Does translation start at the first ATG?

No. The tool translates from the first base of the chosen frame whether or not there is a start codon, so the output begins wherever the frame does. To look only at ATG-to-stop stretches, use the ORF Finder.

What do X and the asterisk mean in the output?

An asterisk is a stop codon. An X marks a codon that cannot be assigned, usually because it contains an ambiguity code such as N or a gap character.

Which genetic code is used?

Only the standard code. Mitochondrial and some bacterial codes differ, for example UGA reads as tryptophan in vertebrate mitochondria, so those genes will translate incorrectly here.

What happens to leftover bases at the end?

One or two bases that cannot form a full codon are ignored. In All 6 frames mode the reverse frames are labeled with a minus sign and come from the reverse complement.

Related tools

• Six-Frame TranslationTranslate a DNA or RNA sequence in all six reading frames (three forward, three reverse) to find coding potential.
• ORF FinderFind open reading frames (ATG to stop) across all six frames, with position, length, and protein.
• Codon OptimizerCodon-optimize a protein or coding sequence for E. coli, human, or yeast expression.
• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• DNA ng / pmol / Copies ConverterConvert nucleic-acid mass, moles, and molecule count from length and type, with molarity.