Sequence Stats

About Sequence Stats

This tool summarizes raw DNA or FASTA records: length, GC percentage, counts of A, T, G and C, ambiguous bases, and an approximate molecular weight. Paste one sequence or a whole multi-record FASTA file and each record gets its own card, which makes it handy for sanity-checking a batch of oligos or contigs.

How to use it

1. Paste raw sequence or FASTA text into the Sequence or FASTA box. Headers begin with a greater-than sign.
2. Check the line under the box to confirm how many records were detected.
3. Read each record's card for length in bp, GC percentage, the A/T/G/C counts and the Other count.
4. Note the MW value, shown in kilodaltons, and remember it is an estimate for a single strand.

One FASTA record

>example sequence
ATGCGGCCGCTAGCTAGCGGCCATATTTGCAATGGCC

37 bp, GC 59.5%, A/T/G/C = 7/8/11/11, Other 0, MW 10.9 kDa

When to use it

• Confirming that every oligo in an order sheet has the length and GC you expected.
• Comparing composition across several contigs pasted as a single FASTA block.
• Estimating how heavy a single-stranded DNA is before working out a molar amount.
• Catching a stray non-nucleotide character that changed a sequence length.

Questions about Sequence Stats

How is molecular weight calculated?

Average nucleotide monophosphate masses are summed (A 313.21, C 289.18, G 329.21, T 304.2), one water is removed per bond, and a 5' phosphate is added. Ambiguous bases count as about 308.95 each.

Is the weight for single- or double-stranded DNA?

Single-stranded. For a duplex you would roughly double it, or use the average of 650 g/mol per base pair, which the DNA quantity converter applies.

What if I paste RNA?

U is converted to T before counting, so the composition is reported as DNA and the weight uses thymidine mass. It is a close approximation, not an exact RNA weight.

What if there is no header line?

The whole box is treated as one record and labeled unnamed. Whitespace, digits and non-nucleotide characters are ignored, and each record is capped at 100,000 bases.

Related tools

• FASTA FormatterParse, clean, validate, and re-wrap FASTA records at a chosen line width.
• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• GC Content CalculatorCalculate GC%, AT%, base counts, and a basic melting temperature for a DNA sequence.
• DNA ng / pmol / Copies ConverterConvert nucleic-acid mass, moles, and molecule count from length and type, with molarity.
• Pairwise Sequence AlignmentGlobal Needleman–Wunsch alignment of two sequences with score, identity, and a visual alignment.