Six-Frame Translation

About Six-Frame Translation

This tool translates a nucleotide sequence in all six reading frames at once: three on the forward strand and three on the reverse-complement strand. Reading the result frame by frame shows which stretches run long without a stop codon, which is the classic clue to a coding region when you do not yet know the reading frame or strand.

How to use it

1. Paste the DNA or RNA into the Nucleotide sequence box. The badge shows the length in nucleotides.
2. Use the All 6, Forward and Reverse toggle to choose which frames to display.
3. Compare frames +1 to +3 and -1 to -3, noting the amino acid count and stop count shown beside each label.
4. Use Copy frames to export the visible frames as FASTA-style records.

All six frames of a 39-nt sequence

ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG

+1 MAIVMGR*KGAR*   +2 WPL*WAAERVPD   +3 GHCNGPLKGCPI   -1 LSGTLSAAHYNGH   -2 YRAPFQRPITMA   -3 IGHPFSGPLQWP

When to use it

• Identifying the correct frame of a sequence fragment with no annotation.
• Finding an unexpected coding stretch on the opposite strand of a construct.
• Spotting a frameshift caused by an insertion or deletion, since the open frame changes.
• Getting all candidate peptides for a mass spectrometry or antibody-epitope search.

Questions about Six-Frame Translation

How are the reverse frames numbered?

They follow the common EMBOSS and ExPASy convention: the sequence is reverse-complemented, and frame -1, -2 or -3 starts at offset 0, 1 or 2 on that new strand.

How is this different from the DNA to Protein tool?

This one always shows the full frames with stop counts, and shows the reverse strand directly. It never truncates at a stop, so you can see what follows one.

Does a frame need a start codon to be shown?

No. Each frame is translated from its first base, so it can begin mid-gene. For ATG-anchored candidates, the ORF Finder is the better fit.

How do I recognize the coding frame?

The right frame usually shows a long uninterrupted run of residues with no asterisk, while wrong frames hit a stop every 20 or so codons on average.

Related tools

• DNA to Protein TranslationTranslate a DNA or RNA sequence into protein across reading frames using the standard genetic code.
• ORF FinderFind open reading frames (ATG to stop) across all six frames, with position, length, and protein.
• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• FASTA FormatterParse, clean, validate, and re-wrap FASTA records at a chosen line width.
• DNA ng / pmol / Copies ConverterConvert nucleic-acid mass, moles, and molecule count from length and type, with molarity.