Codon Optimizer

About Codon Optimizer

This tool back-translates a protein, or translates a coding DNA sequence and then re-encodes it, choosing for each amino acid the codon most often used by a target organism. You pick E. coli, human or yeast. It gives a quick first draft of an expression-ready sequence for gene synthesis.

How to use it

1. Under Input is, choose Protein (1-letter) or DNA / RNA (will translate).
2. Choose the Target organism: E. coli, Human or Yeast.
3. Paste the protein or coding sequence into the box. In DNA mode, a Translated protein block appears so you can check it.
4. Copy the result from the Codon-optimized DNA block with Copy DNA. Badges show residue count and length in bp.

A 15-residue peptide with a stop, E. coli

MASNTVHELLEKLGR*

ATGGCGAGCAACACCGTGCATGAACTGCTGGAAAAACTGGGCCGTTAA

When to use it

• Producing a starting sequence to send to a synthesis vendor for bacterial expression.
• Seeing how the same protein is encoded differently for human cells and for yeast.
• Recoding a cDNA from one organism so it can be expressed in another.
• Making a fully synonymous variant of a gene to avoid recombination with the original.

Questions about Codon Optimizer

What strategy does the optimizer use?

It substitutes the single most frequent codon for every amino acid from a built-in table for the chosen organism. There is no GC balancing, repeat removal or restriction site avoidance.

Why might the result still need editing?

Using one codon everywhere can overload a single tRNA, create repeated stretches that are hard to synthesize and produce unwanted restriction sites or secondary structure. Dedicated design software handles those issues.

Does it add a start or stop codon?

No. A stop is written only where your input contains an asterisk, and the sequence starts with whatever residue is first. Add M at the start if you need an ATG.

What about unusual amino acids?

Letters with no standard codon, such as X, B, Z, J, O and U, become NNN so the output stays exactly three bases per residue instead of shifting the frame.

Related tools

• DNA to Protein TranslationTranslate a DNA or RNA sequence into protein across reading frames using the standard genetic code.
• ORF FinderFind open reading frames (ATG to stop) across all six frames, with position, length, and protein.
• Pairwise Sequence AlignmentGlobal Needleman–Wunsch alignment of two sequences with score, identity, and a visual alignment.
• Six-Frame TranslationTranslate a DNA or RNA sequence in all six reading frames (three forward, three reverse) to find coding potential.
• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.