Codon Usage Analyzer

About Codon Usage Analyzer

This tool tallies how a coding sequence spends its codons. It reports each codon's count, frequency per thousand, share within its synonymous family and relative synonymous codon usage, along with overall GC and GC at the first, second and third codon positions. You can also compare it with an organism's preferred codons.

How to use it

1. Pick an organism under Compare against organism, or choose None (usage only).
2. Paste the coding DNA into the Coding sequence box. It must begin at the first base of a codon, since only frame 1 is read.
3. Read the Summary tiles for overall GC, GC3, GC1 and GC2, and the share of codons matching the preferred codon.
4. Scroll the Codon usage table, which lists only codons that occur, and use Copy table to export it.

34 codons of a fluorescent-protein-like gene against E. coli

ATGGCTAGCAAAGGTGAAGAACTGTTCACCGGTGTTGTTCCGATTCTGGTTGAACTGGATGGTGATGTTAACGGTCACAAATTCTCCGTTTCCGGTGAAGGT

GC 47.1%, GC1 67.6%, GC2 35.3%, GC3 38.2%, 52.9% match preferred. Gly GGT: 6 of 6 Gly codons, RSCU 4.00

When to use it

• Checking whether a gene from one species has codons the expression host handles well.
• Finding a GC3 value that reveals a genome's overall composition bias.
• Comparing the codon choices of a wild-type and a synthesized version of the same protein.
• Screening for rare codon clusters that could slow translation.

Questions about Codon Usage Analyzer

What is RSCU?

Relative synonymous codon usage is the observed count of a codon divided by the count expected if all synonymous codons were used equally. A value of 1 means no preference and higher means favored.

Why is my Met or Trp always 1.00?

They have only one codon each, so there is nothing to choose between and the ratio is always 1 whenever they appear. The same applies to any single-member family.

Is the preferred-codon percentage a codon adaptation index?

No. It is the fraction of your codons that equal the single most-used codon for that organism. It is a quick proxy, not a weighted CAI.

What happens to incomplete or ambiguous codons?

Trailing bases are ignored and codons containing anything other than A, C, G or T are skipped. A frame shift caused by a leading UTR will distort every number.

Related tools

• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• ORF FinderFind open reading frames (ATG to stop) across all six frames, with position, length, and protein.
• GC Content CalculatorCalculate GC%, AT%, base counts, and a basic melting temperature for a DNA sequence.
• FASTA FormatterParse, clean, validate, and re-wrap FASTA records at a chosen line width.
• Six-Frame TranslationTranslate a DNA or RNA sequence in all six reading frames (three forward, three reverse) to find coding potential.