Sequence Manipulator

About Sequence Manipulator

This tool applies one everyday edit at a time to a DNA, RNA or protein sequence: extract a range, soft-mask or hard-mask a region, reverse, complement, reverse-complement or change case. The range operations work on any alphabet, so it suits both nucleotide and protein work.

How to use it

1. Paste the sequence into the Sequence box. A FASTA header line, whitespace and digits are ignored, and the badge counts the residues that remain.
2. Select an operation in the Operation toggle group.
3. For Extract range, Soft-mask or Hard-mask (N), set Start (1-based) and End (inclusive).
4. Copy the output from the Result panel with Copy result.

Positions 5 to 20 of a 39-base sequence

ATGCGTACGTTAGCCGGATCCAAGCTTGGTACCGAGCTC

Extract: GTACGTTAGCCGGATC. Soft-mask: ATGCgtacgttagccggatcCAAGCTTGGTACCGAGCTC. Hard-mask: ATGCNNNNNNNNNNNNNNNNCAAGCTTGGTACCGAGCTC

When to use it

• Cutting out a promoter or CDS from a longer record using known coordinates.
• Marking a repeat or primer-binding region in lowercase while leaving the rest visible.
• Blocking out a region with N before passing the sequence to a tool that should ignore it.
• Changing a whole sequence to uppercase or lowercase to match a file format.

Questions about Sequence Manipulator

What is the difference between soft and hard masking?

Soft masking lowercases the region, so the bases are preserved and can be recovered by uppercasing. Hard masking replaces each base with N, permanently discarding the original letters.

How are coordinates counted?

Positions are 1-based and inclusive, counted on the residues left after the header, whitespace and digits are stripped. A bound outside the sequence is clamped to the sequence's ends.

What happens with a start after the end?

Extract returns an empty result, shown as a dash, while both mask operations hand back the cleaned sequence unchanged.

Why did complementing RNA give me T instead of U?

Complement and reverse-complement clean the input to uppercase nucleotides and read U as T. The result is DNA. They also drop any letter that is not an IUPAC nucleotide code, so they are not meaningful for protein.

Related tools

• DNA Reverse ComplementReverse, complement, or reverse-complement a DNA or RNA sequence (IUPAC ambiguity aware).
• DNA to RNA TranscriptionTranscribe a DNA coding or template strand into mRNA, or reverse-transcribe RNA back to DNA.
• GC Content CalculatorCalculate GC%, AT%, base counts, and a basic melting temperature for a DNA sequence.
• Sequence StatsLength, base composition, GC%, and approximate molecular weight for raw or FASTA sequences.
• FASTA FormatterParse, clean, validate, and re-wrap FASTA records at a chosen line width.
• Pairwise Sequence AlignmentGlobal Needleman–Wunsch alignment of two sequences with score, identity, and a visual alignment.